Table 1. Primers for new microsatellite markers in 21q22.3


Marker

Oligonucleotidesa

Alleles observedb

Product Sizec

Repeats Ld

Repeats Rd

PCR conditions

D21S1260

2111-D21S1260-(AFMA152WD1A)-01 TCCAAGGGGTTCATCC

7

207

   

59O

 

2112-D21S1260-(AFMA152WD1M)-02 CCCAAGGCACTGTTCC

         

D21S212

2169-D21S212-01 GGCCTCCTGGAATAATTCTC

11

250

   

TD58/48

 

2170 D21S212-02 CATTTTAATGAACACCGCTC

         

1016E7.CA60

5070-1016E7.CA60.F CTTTTAGGTCTCAGGGCTTCAG

4

183

LTR/Retroviral

LTR/Retroviral

TD 66/62

 

5071-1016E7.CA60.R CAGAGAAACAGAACCAATGGG

         

834A1.CA78

4491-834A1.CA78F AATCCCTCCGGCCATCATGCAGG

6

199

None

None

TD 68/58

 

4492-834A1.CA78R TTAACAGTCTGTTTCTAGCTTGG

         

834A1.GT86

4489-834A1.GT86F GACTCAGGGCTCAGCCTACTGAC

4

165

None

DNA/MER1_type

TD 60/50

 

4450-834A1.GT86R TGTACAGAAACTCATTGCAGATC

         

D21S1225

2223-D21S1225+L AGAAGTGCCTGGATTCAGC

6

220

   

62O

 

2224-D21S1225+R AGGTTTTACAAATAAGCAGAAAGG

         

White

2416-WpolyT-f TCTCCATTCCCCTTTCTAGC

5

131

   

TD 65/55

 

2417-WpolyT-r TCTCATCACCAGCTGTGTTG

         

169B4.GT118

4740-169B4L AGGAGGAGGGCAGAGAGAAG

4

269-bp

None

None

TD 65/55

 

4741-169B4R CCCTCCACACCAACTGAGAT

         

994G8.CA50

4742-994G8A LTCCGTGCTGTCAACATTCAT

4

162

LTR/MaLR

Low_complexity CA

 
 

4743-994G8A RTGCCTGTCTTTGTATGCATA

         

994G8.CA82

4744-994G8BL CATGGAAATCCCAGCAAAAT

5

170

None

None

TD 65/55

 

4745-994G8BR TTGACATACTGTCCTCCCCC

         

907F12.CA49

4746-907F12L CCACGTAAAGTTGACTAGAC

ND

140

None

None

 
 

4747-907F12R TAGGCCAGTTTCACTCCACC

         

161B8.CA32

4748-161B8LT CCAAATAGGCCAGTGTTCC

6

204

None

None

TD 65/55

 

4749-161B8R GGGAAGGTTGTTGCCATAGA

         

161B8.AT54

5072-161B8.AT54.L GTTGGCCTGCGGATATCTAA

ND

186

LINE/L1

SINE/Alu

 
 

5073-161B8.AT54.R CTTGAGCCCAGGAGTTTGAG

         

D21S1411

6059-UT1355A ATGATGAATGCATAGATGGATG

4

239

   

TD 65/55

 

6060-UT1355:B AATGTGTGTCCTTCCAGGC

         

51A8.1

5323-51A8.1L ATCTGTGGTCCCAACTGCTT

ND

198

SINE/Alu

None

 
 

5324-51A8.1R GCTCCACAAAACCAGCTTTC

         

51A8.2

5325-51A8.2L GAGTGGGGACTCAGCAGAAG

ND

226

None

None

 
 

5326-51A8.2R ACCCAAGCTCAAGCTGTCTC

         

51A8.3

5327-51A8.3L AGTGGGCCGAGATTACACC

ND

260

SINE/Alu

LINE/L1

 
 

5328-51A8.3R GGTTTGCTCTTGCCTTTCTG

         

51A8.4

5329-51A8.4L GTGACCTTGGCTCACTGCAT

ND

224

SINE/Alu

SINE/Alu

 
 

5330-51A8.4R AGCACTTAACGGAGGCTGAG

         

1151C12.GT45

5074-1151C12.GT45.L CCCTTTTTGAATTGGGTTTC

3

137

LINE/L1

SINE/Alu

TD 62/52

 

5075-1151C12.GT45.R TACTTGAGCCCAGGAGTTGG

         

1151C12.AT49

5076-1151C12.AT49.L GGGCAACAAGAGCTAAACTCC

ND

219

SINE/Alu

None

 
 

5077-1151C12.AT49.R AGTGGGATCTGGCCCATAG

         

1151C12.CA69

5078-1151C12.CA69.L GGCAACGAGAGCAAAACTCT

ND

159

SINE/Alu

LINE/L1

 
 

5079-1151C12.CA69.R TCAGTAAAATCATCTGTGCCTGA

         

1151C12.CA80

5080-1151C12.CA80.L CCTCTGCCTGAAGAGCTTTG

ND

250

None

None

 
 

5081-1151C12.CA80.R CACGTGCACATGATCCAAC

         

274G10.GT38

4750-274G10AL ATAGACTGAGTGACAGATTC

ND

178

SINE/Alu

LINE/L1

 
 

4751-274G10AR CCCTCATCCAGATTTTCCAA

         

274G10.CA85

4752-274G10BL GGGAGTGGTGTGTCATTCCT

4

142

None

None

TD 65/55

 

4753-274G10BR GTCTTTGCCGGTGCAGCGA

         

JA-I

4293-JAIR1 GAATACAATTGGCCCTGTGA

7

185

   

TD 65/55

 

2261-D21S141+L TTTTGGAATGTTTCCTTCCAG

         

D21S1890

4985-D21S1890L GGTCTGACCACAGATTTCC

13

169

   

59O

 

4986-D21S1890R AAAAACACTCTGAACGATTAAGG

         

D21S1885

4987-D21S1885L AGCATGGCACTGGCATC

8

165

   

64O

 

4988-D21S1885R AGGACAAGTTTGGCCCC

         

41H11.CA2

4754-41H11L GCCATTGCACTCCAGCCTGG

ND

228

SINE/Alu

None

 
 

4755-41H11R TGCAGATCCTGCTTTGTGAC

         

953G5.CA29

4756-953G5L TGCAGACTCATACAGATAGG

4

137

Low_complexity

None

TD 60/50

 

4757-953G5R GATGTCCCTGGCAATTCAGT

         

22A5.GT124

4758-22A5L GCAGGGTCCAGATTCTGCTA

4

126

None

None

TD 65/55

 

4759-22A5R AGAAACTGTCTCCACCGCAC

         

836E9.GT85

4760-836E9L CCTGCAGCCTTGCTAAATTC

4

201

LINE/L1

LINE/L1

TD 65/55

 

4761-836E9R CAAACCAGAACAACCAAGCA

         

836E9.AT98

5855-836E9.AT98L AACTCTGTGCTGGTCCTTGG

ND

200

None

SINE/Alu

 
 

5856-836E9.AT98R AACTGAGATTGTGCCACTGC

         

836E9.TCC126

5857-836E9.TCC126L GCCTGTCGAAGGTGTAGCTC

ND

149

None

None

 
 

5858-836E9.TCC126R CGCTTATCTATGAGGCCAAA

         

836E9.TTTA129

5859-836E9.TTTA129L TGCTCAGGTGGTTGAGGAAT

1

150

LINE/L1

SINE/Alu

TD 60/50

 

5860-836E9.TTTA129R CTGCGTGACAGAGCGAAA

         

D21S1259

2097-D21S1259-(AFM326TF1A)-01 GGGACTGTAATAAATATTCTGTTGG

6

222

   

55O

 

2098-D21S1259-(AFM326TF1M)-02 CACTGGCTCTCCTGACC

         

218C10.GT38

4762-218C10AL GGTTTTGTTTCCGTTCTGCT

ND

162

None

LINE/L1

 
 

4763-218C10AR TAGATCACATGGTACTCCAT

         

218C10.CA44

4764-218C10BL AGAGGGAGGAGGAAGCAGCT

5

170

None

None

TD 65/55

 

4765-218C10BR ATCCTGTTAGCAGCCCAAGA

         

86A5.GT39

4766-86A5AL ATATGACTGGGTGCTGGGAG

ND

199

None

None

 
 

4767-86A5AR TACTCAGTACACCCCCTGCC

         

86A5.CA74

4768-86A5BL ACCATGCCCAGCCTATACAT

5

156

SINE/Alu

SINE/Alu

TD 65/55

 

4769-86A5BR ATCGCTTGAAATCAGGAGGA

         

86A5.GT77

4770-86A5CL GCTGTGCCCCATTGATTAGT

2

172

None

None

TD 65/55

 

4771-86A5CR TGGTTCTATGGACAGTAAGA

         

D21S1912

2916-D21S1912L CCCTCATACAGATTTAAAACACAC

8

200

   

62o

 

2917-D21S1912R GAGCCCACCCTGGTAAC

         

PFKL

3846-PFKL.PCR1.1 GTGGTACCTCATTGTGGCTA

7

130

   

62o

 

3847-PFKL.PCR1.2 AGGCATCCTTGTGCTGACAT

         

D21S171

1028-D21S171.PCR1.1 GATCAAGTTAAGAGGAGGCT

5

124

   

57O

 

1029-D21S171.PCR1.2 GTGGGCTGCTGCTATCTTTG

         

AJ930.34.TCe

6345- J930.34.TC.L/6345-AJ34.L CTCAGCAGGAGTATATGTCTGAC

2

157

None

None

TD 60/50

 

6346-AJ930.34.TC.R/6346-AJ34.R AGCATGGCCTGGTCCCTCCAGAG

         

AJ930.143.CAe

6347-AJ930.143.CA.L6347-AJ143.L TCACACACATCCCTCCTGGCTGC

3

212

None

None

TD 65/55

 

6348-AJ930.143.CA.R/6348-AJ143.R CAATGCATGCATGCACGGGTTAC

         

S1903

2918 D21S1903L GCTTGCTGAACTCACCTG

14

265

   

57O

 

2919 D21S1903R GCCTCCCAAAGTGCTC

         

S1897

6061-AFMb298xd5a GAGGCTGAGGTGTGAGA

10

200

   

57O

 

6062-AFMb298xd5m CCTGAGTTAAGTGTTAAATAAGTTG

         

223tel.167.TGf

6349-tl167.L AGGATGGACAACAGAGAAGGTG

4

150

None

None

TD 65/55

 

6350-tl167.R GTCATGACCCTGGCTGTGCCAC

         

D21S1575

2286 IA4-02 (21qter-GT3) GAAACCCATCTCACATGCAG

11

311

   

59O

 

2285 IA4-01 (21qter-GT3) GAAGTGCTCTAAGAACTTGC

         

D21S1446

CHLC.GATA70B08.P18017.forward ATGTACGATACGTAATACTTGACAA

5

221

   

TD 65/55

 

CHLC.GATA70B08.P18017.reverse GTCCCAAAGGACCTGCTC

         

a Marker names are from published markers at available the Genome database (http://gdbwww.gdb.org/) or for new markers as follows (with a few exceptions). Name of BAC, sequence repeat type and distance from telomeric side in Kb. E.G 834A1.GT86 is from BAC 834A1, a GT dinucleotide and is approximately 86kb from the centromeric side of the BAC. For details of BAC maps see http://www.dmb.med.keio.ac.jp/seqpub/map/APECED.html.

b The total number of alleles observed is derived from the Genome database (http://gdbwww.gdb.org/), or our own studies, not necessarily from individuals in the DFNB10 family.

c Product sizes are based on the genomic sequences used to derive the polymorphic markers.

d SINE repeats detected either side of the simple repeats used as polymorphisms as detected by repeatmasker (http://ftp.genome.washington.edu/RM/RepeatMasker.html) are annotated.

e Derived from sequence AJ011930

f Derived from sequence AP000216

Markers in bold are new markers.





DGM Home page | Research Home page | Research Contacts