Table 2. Primers used for mutations analysis of the 6 known genes in the DFNB10 critical region


Gene (Orientation)a
Exon(s)
Oligonucleotide primer sequence (F) Oligonucleotide primer sequence (R)
Exon size (bp)
Product size (bp)
PCR condtions
1. White (>)
1
   
36b
   
 
2
GGAAGAAGTGTTGCTATTAATA GTTGGGAAGAGAAGCTCAGCCT
244
476
TD 68/58
 
3
CGTAGACCAGGGAATTCGAAAGAC CTTCCTATCTTCCTCCTGTCCCTTTA
118
567
TD 65/55
 
4
GTGGCCAGTGGTTCAGCTGGGAA CTAGAGGGAGGTTGCTGGCCCTGT
135
409
TD 68/58
 
5
AGTGCGGGCATGAGGCTCACACTGC CCGGCAGGCACACCTTCCACATGCA
51
199
TD 65/55
 
6
CCCAATGTCTCTCGTTCTGTTGC GCTACATCAGGATGTCAGGGTCAC
136
270
TD 65/55
 
7
TAGTTCCTGCCGCCCGCAGGCG TGACCTGAGTGCAGTGGTAATCTGG
124
223
TD 65/55
 
8
GCCTTCCGAGGAAGGCAGGGCTTG TCCCCTTTCTGTCCCCCGAGCTGC
115
209
TD 65/55
 
9-10
TTGGGGTGTCCTTCCTGGAGCC CATTCCGTCAGGACGAGTCTGAG
185/102
552
TD 65/55
 
11
CTGAGCCGAGGACGGCTTTGCGA TTGGTCAAGGCGTGACTTCAGGC
169
308
TD 65/55
 
12
TCGCACATGGTCACTGACCCTTC GGAAGCCCAGCCGTCATGCCCTCAC
101
659
TD 68/58
 
13
GGAGCTTTGCTGTTGGCCTGCT CAGGCCAAGGTAGCTCAGGGAAGC
159
295
TD 65/55
 
14
GGCTGCAGGTTCTGCTACATCTGTC CTGGATCCTCAGATGTGTAATCTGCTC
119
299
TD 65/55
 
15
TCAGCCAACGGCGTGGCTGGCT CTGTGCAGCCATCAGCTGAGAGGCT
1079c
649
TD 65/55
 
15
CAGCTGGTGATGAGAGGCTTCCTCA GCAGCTGAGGTGATACAGGAGG  
642
TD 65/55
             
2. TFF3 (<)
1
GACCAGCCTGGCCAACATGGCGAC TGAGTGAGTCAGGACCCTGCGG
82b
544
TD 62Ø52
 
1
AATCAATTATGTGTACCATGTTTTT TCCTGCATGCCTTTGTCAAGCTCC  
492
TD 62/52
 
1
CCCCAGTAGAGGACCCCGGAAC GAGCCTCGGTTTCCTTGTCTGTG  
537
TD 62/52
 
2
GGCGTGTGCCTCTCCTGTCACGGT CTGGGCCCAGACCACGATGCCAC
147
599
TD 62/52
 
2
CAAGGAGTGCAACAACCGGGG CTGGGGGGCCGATTTGCAAAAACA  
441
TD 62/52
 
3
GCCTGATCCCTGGGTCCCACTATC CGCCCTCTCCCACGACGCAGCAG
191c
474
TD 62/52
             
3. TFF2 (<)
1
CTCCAGACCCTGAGGACAGCCCCGT GGCTGACAGGGTCAGCGGAGTAG
103b
395
TD 68/58
 
1
GATGTAGAGCATTCCCATGGAAC GGCAGCTGTGCCCTGTGCAGGCG  
529
TD 64/54
 
1
CTGGCATGACCCAACTCTCTGTCC GCCACCCTCCTGAGCAGTGGCAAA  
503
TD 65/55
 
1
GCACAACCATAAATTAACTTGAG CCAAGATCACACCACTGCACTCC  
340
TD 65/55
 
2
CAGGATGGTCTTGAACTCCTGA AGCTGGGTCCTGGGTTGCCAGC
150
512
TD 68/58
 
2
GGAATCACCAGTGACCAGTGTT GTCACACTTCAAAAACTAGAGG  
1573
TD 68/58
 
3
TCTAGAGGTAACCCAGGTCAGCC CCAAAGACACTGCCATTCAGTGG
147
518
TD 65/55
 
3
GTGTGCGTGGAACCAGGCACGTC GCAGCCTCCGTGGATCATGAGGT  
477
TD 68/58
 
3
ACCTTCGCGGAGGACAGGCCAGC AGAGAGTCCCACAGCGACGTTACC  
423
TD 65/55
 
4
GGCCTGGGGTGGGAAGATTTGG GCACACCACCATTACCACCTCTGTG
152c
406
TD 68/58
             
4. TFF1 (<)
1
AATACTGTACTCACTGCAGAAGTGATTC CCAGAAGGAGACTTAATCTGTCGCTCAG
125b
480
TD 60/50
 
1
GCTTAGGCCTAGACGGAATGGGC TCGGCCAGGGTGCCGAGGGCCAGCAT  
573
TD 60/50
 
1
TCAGTGGAGATTATTGTCTCAGAGG GTTGGCATGAACAGTCAAAAGCAC  
588
TD 60/50
 
1
AGCAGGTGGAGAGTAACTCAGGG CTAGAAGGACCCAGGGCAACCGA  
458
TD 68/58
 
2
CGCCTCACTGGACAGTTGCTGA GTGATGCTGATCAGAGCCTCTGTA
153
358
TD 60/50
 
3
TTGAAATGGAGTCTCGCTCCGTT GTGAGCCGAGGCACAGCTGCAGA
212c
554
TD 68/58
 
3
GTCCCCAGCACGGTGATTAG CATCCGCAGTGAGTAGTTAAG  
534
TD 60/50
             
5. PDE9A (>)
1
6058-PDEex1F CAGTAAAAAGTCCGAGTGCAGC 6041-PDEex1R TGCCTGTGAAACGGAAACAC
69b
330
TD 65/55
 
2
4594-PDEex2F TTGGAGCCGAAGCGGAAGCACG 4595-PDEex2R CGCATTGATTGATTTCGAAGAG
71
302
 
 
3
4596-PDEex3F TCCTGGGACTGTCCTGGTTGTC 4597-PDEex3R CATCTCTGCTGTCAATTCACAC 
78
306
 
 
4
4598-PDEex4F CTAATCATGCCGAGTGCTTATC 4599-PDEex4R ATTCTGCAGTTGTATCGGCTTC
44
325
 
 
5-6
4600-PDEex5-6F TTGAGACGTGCCTTGCACTCAC 4601-PDEex5-6R CTCCTCCAGGCAGGTGAGACAG
180/55
595
 
 
7
4602-PDEex7F ACAGCAGGGACTCAGTAGGTG 4603-PDEex7R ACTGAACTCCTCCCCGTTCCAAG
71
249
 
 
8
4604-PDEex8F TCTGCACTGAGGTATATTCCTC 4605-PDEex8R GAACTGTACCGAACTGCACCAG 
85
321
 
 
9
4606-PDEex9F CAGAGGTCAGACAGGTCATCAG 4607-PDEex9R ACGTACACACAGCAGGGTCTGG
82
363
 
 
10
4608-PDEex10F CAGCATGCACATCACTGTCACAG 4609-PDEex10R GGTGGTCCCACTGGCGTCCAAG
75
213
 
 
11
4610-PDEex11F TGGCACTCCGAGGACAGCAGAG  4611-PDEex11R AGCGCAGTGCCATCCGGAAGGTG 
87
286
 
 
12-13
4612-PDEex12-13F CAAACCAGCGCACAGCCTTCTG 4613-PDEex12-13R CCGTCGTTGACAGCTCCATCTG 
105/83
779
 
 
14
4614-PDEex14F CTCTACTTGCTCCACTTACATG 4615-PDEex14R AGCTTCCAGCCAATGGAGAGTG
157
465
1
 
15
4616-PDEex15F GTGATGGATGCACATATGAATCG 4617-PDEex15R TTCTTGGCTTCCAGTGTGAGCTG 
114
336
 
 
16-17
4618-PDEex16-17F TCAGTTGCATGGTCCAGCAGGTC 4619-PDEex16-17R TGTGCATGCATGTATCTGAGTG 
105/129
1149
 
 
18
4620-PDEex18F GTTTCCGCACGGAGCACCTGAC 4621-PDEex18R GCACGTCCAAGCTTCTGGAGTC
96
278
 
 
19
4622-PDEex19F CTCCAGGCAACAGAAGCTGCTG 4623-PDEex19R TGTCAGAATCATTGTATGCGCTG 
82
224
 
 
20
4624-PDEex20F TGGTCAGCCTGGTCTCGAACTC 4625-PDEex20R GTCCTTCGTCTCCATGAGAGAAC 
14c
437
 
             
6. NDUVF3 (>)
1
6256-NDUFV3ex1F AGCTGGCCTGTAATTGGCGCAGTC 6257-NDUFV3ex1R GCCCAACTAGGACGGCTAGAGGTC
48b
272
2, 3
 
2
6258-NDUFV3ex2F TCAGGATCGCTTGAGGCCAGGAGT 6259-NDUFV3ex2R CACTGTCGTGCTTCGAAGGCTGAC
121
521
 
 
3
6260-NDUFV3ex3F GAATGCTTGGTAGGTAAGCGCCTG 6261-NDUFV3ex3R GGCCTTGTGACTCTTGAGTGGAT
155c
338
 

a order of genes is centromere to telomere.

b from start codon.

c to stop codon.

1. 5% DMSO.

2. 2,75 mM MgCl2.

3. Touchdown 65 to 55 annealing.



DGM Home page | Research Home page | Research Contacts