Service de Séquençage d'ADN


 


Le Service de Séquençage du CMU a été constitué afin d'optimiser la réalisation des séquences d'ADN au sein de la Génétique Médicale. Par la suite, son activité s'est étendue à tout le CMU.

Le Service est maintenant équipé d'un séquenceur à capillaires ABI 3130 XL qui permet d'analyser plus d'une centaine d'échantillons par jour.

 

Il est ouvert à tout chercheur ou à toute personne intéressée par ce type d'analyses.

Au 1er janvier 2003, le Service de Séquençage a engagé Mlle Laetitia Pignat .

Dr. Colette Rossier est la personne responsable du Service et son répondant administratif est le Pr. Antonarakis.



Contact

Mlle Laetitia Pignat.   Colette Rossier

      Génétique Médicale
      CMU
      Rue Michel-Servet 1
      1211 GENEVE 4

      E-mail : sequence-adn@medecine.unige.ch

      Tel. 022 379 56 97
      Fax.022 379 56 07



DGM Home page | Research Projects | Research Contacts

1. Que propose le Service ?

Les séquences sont réalisées à partir des matrices ( plasmides, produits pcr) et des primers que chaque utilisateur apporte au Service.
Les primers courants du type SP6, T3, T7, M13F et M13R sont gracieusement mis à disposition.

La réaction de séquençage proprement dite est réalisée à l'aide des kits :
- BigDye Terminator version 1.1 / 3.1 (Applied Biosystems) pour les produits pcr et /ou bandes extraites d'un gel

Les produits de séquençage obtenus sont analysés à l'aide du Séquenceur automatique à capillaires ABI 3130 XL (Applied Biosystems).

Pour chaque séquence, un chromatogramme imprimé ainsi qu'un fichier texte est remis à chaque utilisateur par mail et/ou par poste.

Le Service se tient à disposition pour tout conseil concernant la stratégie de séquençage à adopter.

Nous proposons notre savoir-faire quant à la qualité et la quantité d'ADN nécessaire à ce type de réaction, essentiels pour la réalisation d'une séquence optimale.
Mais n'hésitez pas et consultez la rubrique : Conseils à l'utilisateur !

Le service est toujours intéressés dans le développement de nouvelles techniques afin d’étendre son expérience et satisfaire ainsi un plus grand nombre d’utilisateurs. Alors n’hésitez pas à nous contacter !..

Retour en haut de la page

2. Quelle est la technique utilisée ?

La principale technique utilisée, celle du Dye Terminator est une adaptation de la technique de Sanger à la fluorescence. A chaque type de didéoxynucléotides est associé un fluorophore spécifique. La réaction de séquençage produite par PCR génère des fragments porteurs de fluorophores terminaux.

Après précipitation à l'éthanol de la réaction de séquençage, les fragments obtenus sont suspendus dans le tampon de chargement spécifique au séquenceur à capillaires ABI 3130 XL.

Après injection électrocinétique des fragments d'adn, ces derniers sont soumis à électrophorèse.La migration des fragments fluorescents au travers d'une cellule de détection permet au système optique du séquenceur (laser et caméra CCD) de collecter la fluorescence portée par chacun de ces fragments et de transmettre ces informations l'ordinateur. Les résultats analysés peuvent être visualisés en direct pendant l'électrophorèse. Un chromatogramme et un fichier texte sont ensuite générés.


Retour en haut de la page


3. La réaction de séquençage

La réaction de séquençage utilise l'extension par primer (PCR) d'où le nom de " cycle sequencing ". L'AmpliTaq Polymérase allonge le primer jusqu'à incorporation d'un didéoxynucléotide marqué par un fluorophore. A chaque cycle, un brin de matrice est copié. L'amplification de 25 cycles est donc linaire. S'il y a une erreur de transcription de la matrice, par probabilité, elle ne sera pas visible sur votre séquence.

Retour en haut de la page


4. Quels sont les kits utilisés ?

ABI PRISM BigDye Terminators v1.1 / v3.1 Sequencing Kit (Applied Biosystems)

Les versions 1.1 et 3.1 du kit ont été développées plus spécialement pour les séquenceurs à capillaires. Ces versions plus robustes que les précédentes donnent de meilleurs résultats pour des séquences complexes telles que les répétitions C-T, G-T et A-G.
Les séquences riches en GC ne sont donc plus un problème !

L'enzyme

L'AmpliTaq FS (Fluorescent Sequencing) a été spécialement développée pour le séquençage automatique utilisant les fluorophores BigDye Terminators.
Pour fonctionner, elle nécessite une concentration en dNTP normaux et ddNTP fluorescents 10 x inférieure à une réaction PCR courante. Ceci simplifie la purification des produits de séquençage, une simple précipitation à l'éthanol étant suffisante.

Les conditions réactionnelles du kit (2mM MgCl2 et annealing à 50°C) ont été optimisées de manière à obtenir une distribution égale du signal entre 10 et 700 bases quelle que soit la matrice séquencée.

Les BigDye Terminators

Les BigDye Terminators sont des ddNTPs auxquels ont été adjoint plusieurs groupes fluorescents transmetteur d'énergie. A chaque base (A, T, G, C) est associée une longueur d'onde différente qui se retrouve symboliquement sur le chromatogramme sous forme de rouge pour T, noir pour G, bleu pour C, vert pour A. Chaque ddNTP BigDye porte simultanément son fluorophore de couleur et le fluorophore FAM, amplificateur d'énergie. Après excitation par le laser, ces molécules hautement fluorescentes émettent de la lumière qui est captée par la caméra présente dans le séquenceur.

La superposition spectrale des différentes longueurs d'onde étant pratiquement nulle aucune perte de signal n'est observée.

Ceci conduit un bruit de fond réduit au niveau de la séquence, une meilleure résolution des bases et une lecture automatique plus longue.

 

Retour en haut de la page


5. LES MATRICES


Nous séquençons les ADN doubles brins, plasmides, phages et produits PCR.
Par rapport au séquençage manuel classique, le séquençage automatique nécessite des matrices parfaitement propres et correctement dosées.
La qualité de la séquence obtenue sera en directe relation avec la qualité de la matrice.
Pour la préparation de plasmides, nous vous recommandons l'utilisation des kits commerciaux classiques (QIAGEN, Concert Life Technologies,..).
La lyse alcaline classique suivie d'une extraction phénol/chloroforme et d'une précipitation à l'éthanol donne habituellement de bons résultats.
La préparation des produits PCR et des phages à l'aide des kits commerciaux - QIAGEN, Concert Life Technologies,…- est fortement conseillée.

La quantité de matériel est aussi un facteur important pour une belle séquence.

Il est donc primordial de nous fournir vos échantillons dosés le plus précisément possible, par gel d'agarose ou par spectrophotométrie. Si vous avez du mal à estimer la concentration d'un échantillon sur gel, apportez-nous la photo d'un gel sur lequel vous aurez mis vos échantillons et un marqueur de quantité.
Dans un but d'information générale, si vous nous indiquez les techniques que vous utilisez, ceci sera profitable pour chacun.

Retour en haut de la page


6. Quelles sont les quantités d'ADN requises pour une réaction de séquence ?

Les échantillons sont dilués dans un volume maximal de 5 ul  H2O

Type de matrice
Taille
Quantité /Réaction
Produit PCR
100-1'000 pb
20 ngr
Produit PCR
1 – 2 kb
20 – 40 ngr
Produit PCR
> 2 kb
20 – 50 ngr
Plasmide
3 -15 kb
200 ngr
Phage Lambda
15 - 50 kb
200  - 300 ngr
Cosmide, BAC
 
500 ngr – 1 ugr
ADN génomique bactérien
 
2.5 ugr

Une bonne purification et une quantification précise de vos adn sont des facteurs importants pour la réussite d'une belle séquence.

Retour en haut de la page


7. LES PRIMERS

Dans chaque réaction, nous utilisons 5 pmoles ou 20/40 ngr de primer.Vous pouvez donc nous les apporter aux concentrations indiquées. Les primers que vous dessinez commenceront de préférence par un A ou un T et se terminerons par un G ou un C. Veillez à ne pas répéter 3 fois la même base de suite. Les primers de 18 à 22 mers marchent bien.

Les primers suivants vous sont gracieusement offerts par le Service de Séquençage .

 

SP6 5'ATTTAGGTGACACTATAG 3' 19 mers
T3 5'ATTAACCCTCACTAAAGGGA 3' 20 mers
T7 5'TAATACGACTCACTATAGGG 3' 20 mers
BghR 5'TTGATCTTCCGTGTCAGCTCC 3' 21 mers
M13 Forward (-40) 5'GTTTTCCCAGTCACGAC 3' 17 mers
M13 Forward (-47) 5'CGCCAGGGTTTTCCCAGTCACGAC 3' 24 mers
M13 Reverse 5'CAGGAAACAGCTATGAC 3' 17 mers
M13 Reverse 5'TCACACAGGAAACAGCTATGAC 3' 22 mers

 

Vous n'avez donc pas besoin de nous les apporter !

Retour en haut de la page


8. Conseils à l'utilisateur

A. Produits pcr : kit Abi v1.1

Pcr à un volume final de 50 ul
Purification des produits pcr sur colonne
Dernière élution dans 30 ul d’H2O
Mesure précise de la concentration (nanodrop conseillé)

B. Plasmides pcr : kit Abi v3.1

Elution dans H2O
Mesure précise de la concentration (nanodrop conseillé)

Une concentration exacte du produit pcr ou du plasmide à séquencer permet d’obtenir une meilleure séquence.


Retour en haut de la page


9. A quel prix ?

Dès janvier 2010, une séquence (un ADN et un primer) vous est facturée 15 Frs.

Retour en haut de la page


10. Comment procéder si vous désirez une séquence ?

Le Service de Séquençage se trouve dans le local 2002, au 2ème étage dans les bâtiments A et B du CMU. Vous pouvez nous téléphoner au 022 / 379 56 97 (les chiffres en gras concernent l'interne) ou envoyer un mail à : sequence-adn@unige.ch
Vous pouvez apporter directement vos tubes à cet endroit-là avec une note décrivant le travail à effectuer avec votre nom ou nous l'envoyer par la poste. L'ADN résiste très bien au temps que demande le trajet de chez vous jusqu'à chez nous. Si c'est la première fois que vous vous adressez à nous, il serait pratique que vous remplissiez la fiche d'inscription qui nous donnera tous les renseignements administratifs dont nous avons besoin.

Retour en haut de la page


11. Quels sont les délais d'exécution ?

Si échantillons déposés avant 9h30 du matin :
24 à 48 heures pour 20 à 30 échantillons
Au-delà de 30 échantillons : 2 à 3 jours.

Retour en haut de la page


12. Sous quelle forme trouverez-vous vos résultats ?

Lorsqu'une séquence est exécutée, elle génère deux types de fichiers : un fichier « .seq » et un fichier « .ab1 ». Ces fichiers vous sont envoyés par mail.
Le chromatogramme de chaque séquence est imprimé et vous le trouverez dans le bac qui se trouve sur le frigo du labo 2002.
Vos tubes se trouvent dans ce même frigo. En aucun cas ils sont jetés.
Traitement informatique du fichier «  .seq »
Ce fichier contient la suite en base sous forme de texte. Pour l'ouvrir, remplacer l'extension « .seq » par « .txt ». N'importe quel programme de texte - par exemple word - peut l'ouvrir.
Traitement informatique du fichier «  .abi »
Ce fichier contient le chromatogramme. Il ne peut être ouvert qu’avec un programme spécifique de traitement des séquences dont la liste se trouve ci-dessous (point 13).

Depuis août 1997, les données obtenues sont stockées sur CD et sont accessibles à n'importe quel moment par les utilisateurs. Pour les retrouver aisément, leurs dates d'exécution  doivent être connues.



13. Programmes d'analyse

A utiliser sur MAC : Programme de conversion des fichiers PC en fichiers MAC : le demander au service de séquençage

To download EditWiew : www.appliedbiosystems.com/support/software/

To download Chromas : http://bioinformatics.weizmann.ac.il/software/chromas/

To download EditWiew et Chromas: uofadna.arl.arizona.edu/users/dna_install_info.html

To download Sequencher pour MAC/PC : www.genecodes.com

 

Retour en haut de la page



DGM Home page | Research Projects | Research Contacts